Rat PD1/PDCD1/CD279 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:CGF687-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
854bp
Gene Synonym
Pdcd1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat programmedcelldeath1 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.
References
  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • TOP