Rat IL18R1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001106905.2

RefSeq ORF Size

1614bp

Gene Synonym

Il18r1, Il18r1_predicted

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interleukin 18 receptor 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interleukin-18 receptor 1 (IL18R1) also known as CD218 antigen-like family member A, CDw218a, IL1 receptor-related protein and CD218a, is an interleukin receptor of the immunoglobulin superfamily. IL18R1 is found expressed in lung, leukocytes, spleen, liver, thymus, prostate, small intestine, colon, placenta, and heart, and is absent from brain, skeletal muscle, pancreas, and kidney. High level of expression is found in Hodgkin disease cell lines. This receptor is specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IL18R1 contains 3 Ig-like C2-type (immunoglobulin-like) domains and 1 TIR domain. It is a single-pass type I membrane protein. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. The increased expression of IL18R1 may contribute pathogenically to disease and is therefore a potential therapeutic target. The absence of a genetic association in the IL18R1 gene itself suggests regulation from other parts of the genome, or as part of the inflammatory cascade in multiple sclerosis without a prime genetic cause.

References

Nadif R, et al.. (2006) IL18 and IL18R1 polymorphisms, lung CT and fibrosis: A longitudinal study in coal miners. Eur Respir J. 28(6): 1100-5.

Haralambieva IH, et al.. (2011) Common SNPs/haplotypes in IL18R1 and IL18 genes are associated with variations in hum oral immunity to smallpox vaccination in Caucasians and African Americans. J Infect Dis. 204(3): 433-41.

Hulin-Curtis SL, et al.. (2012) Evaluation of IL18 and IL18R1 polymorphisms: genetic susceptibility to knee osteoarthritis. Int J Immunogenet. 39(2): 106-9.

Catalog Number:DGD933-CY