Canine Carbonic Anhydrase IX/CA9 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Canine

NCBI Ref Seq

NM_001145174.1

RefSeq ORF Size

1314bp

Gene Synonym

CAR9

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine carbonic anhydrase IX Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

References

Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.

Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.

Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.

Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.

Catalog Number:HGB098-NO