Rat CD31/PECAM-1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGB333-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2037bp
Gene Synonym
CD31, Pecam, MGC124998, Pecam1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat platelet/endothelial cell adhesion molecule 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.
References
  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.
  • TOP