Rat IFITM3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001136124.1

RefSeq ORF Size

414bp

Gene Synonym

rat8, DSPA2b

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat interferon induced transmembrane protein 3 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.

References

Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.

Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.

Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.

Catalog Number:FGD809-CO