Rat IFITM3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:FGD809-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
414bp
Gene Synonym
rat8, DSPA2b
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interferon induced transmembrane protein 3 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.
References
  • Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.
  • Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.
  • Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.
  • TOP