Human AXL transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_021913.3

RefSeq ORF Size

2703 bp

Gene Synonym

AXL, JTK11, UFO

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human AXL receptor tyrosine kinase, transcript variant 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

HindIII + NotI(6kb+2.7kb)

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine kinases. In the nervous system, Axl and its ligand Growth-arrest-specific protein 6 (Gas6) are expressed on multiple cell types. Axl functions in dampening the immune response, regulating cytokine secretion, clearing apoptotic cells and debris, and maintaining cell survival. Axl is upregulated in various disease states, such as in the cuprizone toxicity-induced model of demyelination and in multiple sclerosis (MS) lesions, suggesting that it plays a role in disease pathogenesis. Axl expression correlates with poor prognosis in several cancers. Axl mediates multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Axl contributes to cell survival, migration, invasion, metastasis and chemosensitivity justify further investigation of Axl as novel therapeutic targets in cancer. The receptor tyrosine kinase AXL is thought to play a role in metastasis. The soluble AXL receptor as a therapeutic candidate agent for treatment of metastatic ovarian cancer. GAS6/AXL targeting as an effective strategy for inhibition of metastatic tumor progression in vivo.

References

Weinger JG, et al. (2011) Loss of the receptor tyrosine kinase Axl leads to enhanced inflammation in the CNS and delayed removal of myelin debris during Experimental Autoimmune Encephalomyelitis. J Neuroinflammation. 8: 49.

Linger RM, et al. (2010) Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors. Expert Opin Ther Targets. 14(10): 1073-90.

Cavet ME, et al. (2010) Gas6-Axl pathway: the role of redox-dependent association of Axl with nonmuscle myosin IIB. Hypertension. 56(1): 105-11.

Rankin EB, et al. (2010) AXL is an essential factor and therapeutic target for metastatic ovarian cancer. Cancer Res. 70(19): 7570-9.

Catalog Number:HGA691-CY