Human AXL transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:HGA691-NH

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2703 bp
Gene Synonym
AXL, JTK11, UFO
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human AXL receptor tyrosine kinase, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
HindIII + NotI(6kb+2.7kb)
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine kinases. In the nervous system, Axl and its ligand Growth-arrest-specific protein 6 (Gas6) are expressed on multiple cell types. Axl functions in dampening the immune response, regulating cytokine secretion, clearing apoptotic cells and debris, and maintaining cell survival. Axl is upregulated in various disease states, such as in the cuprizone toxicity-induced model of demyelination and in multiple sclerosis (MS) lesions, suggesting that it plays a role in disease pathogenesis. Axl expression correlates with poor prognosis in several cancers. Axl mediates multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Axl contributes to cell survival, migration, invasion, metastasis and chemosensitivity justify further investigation of Axl as novel therapeutic targets in cancer. The receptor tyrosine kinase AXL is thought to play a role in metastasis. The soluble AXL receptor as a therapeutic candidate agent for treatment of metastatic ovarian cancer. GAS6/AXL targeting as an effective strategy for inhibition of metastatic tumor progression in vivo.
References
  • Weinger JG, et al. (2011) Loss of the receptor tyrosine kinase Axl leads to enhanced inflammation in the CNS and delayed removal of myelin debris during Experimental Autoimmune Encephalomyelitis. J Neuroinflammation. 8: 49.
  • Linger RM, et al. (2010) Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors. Expert Opin Ther Targets. 14(10): 1073-90.
  • Cavet ME, et al. (2010) Gas6-Axl pathway: the role of redox-dependent association of Axl with nonmuscle myosin IIB. Hypertension. 56(1): 105-11.
  • Rankin EB, et al. (2010) AXL is an essential factor and therapeutic target for metastatic ovarian cancer. Cancer Res. 70(19): 7570-9.
  • TOP