Human AXL transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_021913.3

RefSeq ORF Size

2703 bp

Gene Synonym

AXL, JTK11, UFO

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human AXL receptor tyrosine kinase, transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

HindIII + NotI(6kb+2.7kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Axl receptor tyrosine kinase, together with Tyro3 and Mer, constitute the TAM family of receptor tyrosine kinases. In the nervous system, Axl and its ligand Growth-arrest-specific protein 6 (Gas6) are expressed on multiple cell types. Axl functions in dampening the immune response, regulating cytokine secretion, clearing apoptotic cells and debris, and maintaining cell survival. Axl is upregulated in various disease states, such as in the cuprizone toxicity-induced model of demyelination and in multiple sclerosis (MS) lesions, suggesting that it plays a role in disease pathogenesis. Axl expression correlates with poor prognosis in several cancers. Axl mediates multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Axl contributes to cell survival, migration, invasion, metastasis and chemosensitivity justify further investigation of Axl as novel therapeutic targets in cancer. The receptor tyrosine kinase AXL is thought to play a role in metastasis. The soluble AXL receptor as a therapeutic candidate agent for treatment of metastatic ovarian cancer. GAS6/AXL targeting as an effective strategy for inhibition of metastatic tumor progression in vivo.

References

Weinger JG, et al. (2011) Loss of the receptor tyrosine kinase Axl leads to enhanced inflammation in the CNS and delayed removal of myelin debris during Experimental Autoimmune Encephalomyelitis. J Neuroinflammation. 8: 49.

Linger RM, et al. (2010) Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors. Expert Opin Ther Targets. 14(10): 1073-90.

Cavet ME, et al. (2010) Gas6-Axl pathway: the role of redox-dependent association of Axl with nonmuscle myosin IIB. Hypertension. 56(1): 105-11.

Rankin EB, et al. (2010) AXL is an essential factor and therapeutic target for metastatic ovarian cancer. Cancer Res. 70(19): 7570-9.

Catalog Number:HGA691-NM